ID c-Ha-ras STANDARD; ds-DNA; PRI; 6453 bp. XX DE Human (genomic clones lambda-[SK2-T2, HS578T]; cDNA clones RS-[3,4, DE 6]) c-Ha-ras1 proto-oncogene, complete coding sequence. XX AC J00277 J00206 J00276 K00954 XX DT 15-MAR-1988 XX OS Homo sapiens DNA. OC Homo sapiens OC Eukaryota; Animalia; Chordata; Vertebrata; Mammalia; Theria; OC Eutheria; Primates; Haplorhini; Catarrhini; Hominidae. XX RN [1] RP 1638-1968 RA Tabin,C.J., Bradley,S.M., Bargmann,C.I., Weinberg,R.A., RA Papageorge,A.G., Scolnick,E.M., Dhar,R., Lowy,D.R. and Chang,E.H.; RT "Mechanism of activation of a human oncogene"; RL Nature 300, 143-149 (1982). RN [2] RP 1044-1973 RA Reddy,P.E., Reynolds,R.K., Santos,E. and Barbacid,M.; RT "A point mutation is responsible for the acquisition of transforming RT properties by the T24 human bladder carcinoma oncogene"; RL Nature 300, 149-152 (1982). RN [3] RP 1664-1774 RA Taparowsky,E., Suard,Y., Fasano,O., Shimuzu,K., Goldfarb,M. and RA Wigler,M.; RT "Activation of the T24 bladder carcinoma transforming gene is linked RT to a single amino acid change"; RL Nature 300, 762-765 (1982). RN [4] RP 1659-1774; 2042-2220; 2374-2533; 3231-3355; 3470-3749 RA Fasano,O., Taparowsky,E., Fiddes,J., Wigler,M. and Golfarb,M. RT "Sequence and structure of the coding region of the human H-ras-1 RT gene from T24 bladder carcinoma cells"; RL J. Mol. Appl. Genet. 2, 173-180 (1983). RN [5] RP 1-6453 RA Capon,D.J., Chen,E.Y., Levinson,A.D., Seeburg,P.H. and Goeddel,D.V.; RT "Complete nucleotide sequences of the T24 human bladder carcinoma RT oncogene and its normal homologue": RL Nature 302, 33-37 (1983). RN [6] RP 1664-1774; 1963-2419 RA Yuasa,Y., Srivastava,S.K., Dunn,C.Y., Rhim,J.S., Reddy,P.E. and RA Aaronson,S.A.; RT "Acquisition of transforming properties by alternative point RT mutations within c-bas/has human proto-oncogene"; RL Nature 303, 775-779 (1983). RN [7] RP 1-4164 RA Reddy,P.E.; RT "Nucleotide sequence analysis of the T24 human bladder carcinoma RT oncogene"; RL Science 220, 1061-1063 (1983). RN [8] RP 1044-3941 RA Sekiya,T., Fushimi,M., Hori,H., Hirohashi,S., Nishimura,S. and RA Sugimura,T.; RT "Molecular cloning and the total nucleotide sequence of the human RT c-Ha-ras-1 gene activated in a melanoma from a Japanese patient"; RL Proc. Natl. Acad. Sci. U.S.A. 81, 4771-4775 (1984). RN [9] RP 1664-1774 RA Kraus,M.H., Yuasa,Y. and Aaronson,S.A. RT "A position 12-activated H-ras oncogene in all HS578T mammary RT carcinosarcoma cells but not normal mammary cells of the same RT patient"; RL Proc. Natl. Acad. Sci. U.S.A. 81, 5384-5388 (1984). RN [10] RP 2042-2220 RA Kraus,M.H.; RL Unpublished (1985) LCMB, NCI, NIH Bldg.37 Rm.1C03, Bethesda, Md. XX XX The human genome contains a family of genes with homology to the XX Harvey murine sarcoma virus oncogene (c-Ha-ras). Two of these XX homologues are detectable by high stringency Southern XX hybridizations; the c-Ha-ras1 and c-Ha-ras2 genes, which occur on XX BamHI fragments of varying sizes from 3 to 9 kb because of allelic XX polymorphisms in the flanking regions. XX XX Genomic mapping and nucleotide sequencing has shown that c-Ha-ras1 XX is the normal progenitor of the transforming gene found in several XX human tumor cell lines (T24 bladder carcinoma; EJ bladder XX carcinoma; Hs242 lung carcinoma; SK2 melanoma; and HS578T mammary XX carcinosarcoma). The only difference within the coding exons of XX the c-Ha-ras1 proto-oncogene and the oncogene of the T24 and EJ XX cell lines is a 'g' to 't' transversion within codon 12 that XX results in the substitution of valine for glycine at this position XX in the p21 protein encoded by c-Ha-ras1. The mutation responsible XX for transforming ability of the p21 protein in the SK2 and Hs242 XX cell lines is an 'a' to 't' transversion within codon 61 that XX results in the substitution of leucine for glutamine at this XX position. The mutation responsible for transforming ability of the XX p21 protein in the HS578T cell line is a 'g' to 'a' transition XX within codon 12 that results in the substitution of Aspartic acid XX for glycine at this position [9]. Because this 'g' to 'a' XX transition abolishes a MspI/HpaII site within the transformed XX allele, [9] was able to determine that both of the H-ras1 alleles XX found in normal cells from the same individual from which the XX HS578T cells were obtained, had the normal sequence at this XX position. XX XX A region of repeated DNA consisting of the 28bp consensus sequence XX 'cactcccccttctctccaggggacgcca' begins at position 4755. The repeat XX occurs 29 times in the plasmid used for this sequence but may occur XX more times in the native DNA. This region is known to be XX unessential for transforming activity [5]. XX XX [5] constructs a chimeric SV40 early promoter/human c-Ha-ras1 XX plasmid to demonstrate that upon transfection transforming activity XX is unaffected. [2],[5] and [7] discuss the extensive homology with XX the retroviral onc genes (v-has, v-bas, v-ha-ras). XX Complete source information: XX Human genomic DNA [3],[1],[5]; human bladder carcinoma cell line XX T24 DNA [3],[2],[5],[7]; cDNA to mRNA, clones RS-3, RS-4 and RS-6 XX [4]; human bladder carcinoma cell line EJ DNA [1]; human lung XX carcinoma cell line Hs242 DNA [6]; human melanoma cell line SK2 XX DNA, clone lambda-SK2-T2 [8]; human mammary carcinosarcoma cell XX line SH578T DNA, clone lambda-HS578T [9],[10] XX FT KEY Location/Qualifiers FT conflict replace(675..678,"") FT /citation=Science 220, 1061-1063 (1983) FT variation 675..678 FT /note="cgga in nontransforming cells; taag in T24 [7]" FT variation 679..680 FT /note="cg in nontransforming cells; cggcggcg in T24" FT allele 1654 FT /note="c in [5],[7]; t in [2],[1],[7] (nontransforming FT cells)" FT conflict replace(1654,"") FT /citation=Nature 300, 143-149 (1982) FT variation 1654 FT /note="c in T24; t in EJ [7]" FT exon <1664..1774 FT /number=1 FT /note="c-Ha-ras1 p21 protein" FT prim_transcript <1664..3744 FT /note="c-Ha-ras1 mRNA" FT CDS join(1664..1774,2042..2220,2374..2533,3231..3350) FT /note="c-Ha-ras1 p21 protein" FT /codon_start=1 FT mutation 1698 FT /note="g in nontransforming cells; t in T24 and EJ cells FT [3],[2],[1],[5],[7],[4]; a" FT allele 1744 FT /note="t in one allele; c in two other alleles [3],[5]" FT intron 1775..2041 FT /note="c-Ha-ras1 intron a" FT conflict replace(1783,"") FT /citation=Proc. Natl. Acad. Sci. U.S.A. 81, 4771-4775 FT (1984) FT exon 2042..2220 FT /number=2 FT mutation 2112 FT /note="a in nontransforming cells; t in Hs242 and SK2 FT transforming cells [6],[8]" FT intron 2221..2373 FT /note="c-Ha-ras1 intron b" FT conflict replace(2328,"") FT /citation=Nature 303, 775-779 (1983) FT exon 2374..2533 FT /number=3 FT intron 2534..3230 FT /note="c-Ha-ras1 intron c" FT conflict replace(2707,"") FT /citation=Proc. Natl. Acad. Sci. U.S.A. 81, 4771-4775 FT (1984) FT variation 2713 FT /note="a in nontransforming cells; g in T24 and SK2 cells" FT conflict replace(3117..3120,"") FT /citation=Science 220, 1061-1063 (1983) FT exon 3231..>3350 FT /number=4 FT /note="c-Ha-ras1 p21 protein" FT allele 3662 FT /note="c in two alleles and T24 [5],[7]; t in one allele FT [7]" FT conflict replace(4099,"") FT /citation=Science 220, 1061-1063 (1983) FT source 1..6453 FT /organism="Homo sapiens" FT /sequenced_mol="DNA" XX SQ SEQUENCE 6453 bp; 946 a; 2287 c; 2113 g; 1107 t; ggatcccagc ctttccccag cccgtagccc cgggacctcc gcggtgggcg gcgccgcgct 60 gccggcgcag ggagggcctc tggtgcaccg gcaccgctga gtcgggttct ctcgccggcc 120 tgttcccggg agagcccggg gccctgctcg gagatgccgc cccgggcccc cagacaccgg 180 ctccctggcc ttcctcgagc aaccccgagc tcggctccgg tctccagcca agcccaaccc 240 cgagaggccg cggccctact ggctccgcct cccgcgttgc tcccggaagc cccgcccgac 300 cgcggctcct gacagacggg ccgctcagcc aaccggggtg gggcggggcc cgatggcgcg 360 cagccaatgg taggccgcgc ctggcagacg gacgggcgcg gggcggggcg tgcgcaggcc 420 cgcccgagtc tccgccgccc gtgccctgcg cccgcaaccc gagccgcacc cgccgcggac 480 ggagcccatg cgcggggcga accgcgcgcc cccgcccccg ccccgccccg gcctcggccc 540 cggccctggc cccgggggca gtcgcgcctg tgaacggtga gtgcgggcag ggatcggccg 600 ggccgcgcgc cctcctcgcc cccaggcggc agcaatacgc gcggcgcggg ccgggggcgc 660 ggggccggcg ggcgtaagcg gcggcggcgg cggcgggtgg gtggggccgg gcggggcccg 720 cgggcacagg tgagcgggcg tcgggggctg cggcgggcgg gggccccttc ctccctgggg 780 cctgcgggaa tccgggcccc acccgtggcc tcgcgctggg cacggtcccc acgccggcgt 840 acccgggagc ctcgggcccg gcgccctcac acccgggggc gtctgggagg aggcggccgc 900 ggccacggca cgcccgggca cccccgattc agcatcacag gtcgcggacc aggccggggg 960 cctcagcccc agtgcctttt ccctctccgg gtctcccgcg ccgcttctcg gccccttcct 1020 gtcgctcagt ccctgcttcc caggagctcc tctgtcttct ccagctttct gtggctgaaa 1080 gatgcccccg gttccccgcc gggggtgcgg ggcgctgccc gggtctgccc tcccctcggc 1140 ggcgcctagt acgcagtagg cgctcagcaa atacttgtcg gaggcaccag cgccgcgggg 1200 cctgcaggct ggcactagcc tgcccgggca cgccgtggcg cgctccgccg tggccagacc 1260 tgttctggag gacggtaacc tcagccctcg ggcgcctccc tttagccttt ctgccgaccc 1320 agcagcttct aatttgggtg cgtggttgag agcgctcagc tgtcagccct gcctttgagg 1380 gctgggtccc ttttcccatc actgggtcat taagagcaag tgggggcgag gcgacagccc 1440 tcccgcacgc tgggttgcag ctgcacaggt aggcacgctg cagtccttgc tgcctggcgt 1500 tggggcccag ggaccgctgt gggtttgccc ttcagatggc cctgccagca gctgccctgt 1560 ggggcctggg gctgggcctg ggcctggctg agcagggccc tccttggcag gtggggcagg 1620 agaccctgta ggaggacccc gggccgcagg cccctgagga gcgatgacgg aatataagct 1680 ggtggtggtg ggcgccggcg gtgtgggcaa gagtgcgctg accatccagc tgatccagaa 1740 ccattttgtg gacgaatacg accccactat agaggtgagc ctagcgccgc cgtccaggtg 1800 ccagcagctg ctgcgggcga gcccaggaca cagccaggat agggctggct gcagcccctg 1860 gtcccctgca tggtgctgtg gccctgtctc ctgcttcctc tagaggaggg gagtccctcg 1920 tctcagcacc ccaggagagg agggggcatg aggggcatga gaggtaccag ggagaggctg 1980 gctgtgtgaa ctccccccac ggaaggtcct gagggggtcc ctgagccctg tcctcctgca 2040 ggattcctac cggaagcagg tggtcattga tggggagacg tgcctgttgg acatcctgga 2100 taccgccggc caggaggagt acagcgccat gcgggaccag tacatgcgca ccggggaggg 2160 cttcctgtgt gtgtttgcca tcaacaacac caagtctttt gaggacatcc accagtacag 2220 gtgaaccccg tgaggctggc ccgggagccc acgccgcaca ggtggggcca ggccggctgc 2280 gtccaggcag gggcctcctg tcctctctgc gcatgtcctg gatgccgctg cgcctgcagc 2340 ccccgtagcc agctctcgct ttccacctct cagggagcag atcaaacggg tgaaggactc 2400 ggatgacgtg cccatggtgc tggtggggaa caagtgtgac ctggctgcac gcactgtgga 2460 atctcggcag gctcaggacc tcgcccgaag ctacggcatc ccctacatcg agacctcggc 2520 caagacccgg caggtgaggc agctctccac cccacagcta gccagggacc cgccccgccc 2580 cgccccagcc agggagcagc actcactgac cctctccctt gacacagggc agccgctctg 2640 gctctagctc cagctccggg accctctggg accccccggg acccatgtga cccagcggcc 2700 cctcgcactg taggtctccc gggacggcag ggcagtgagg gaggcgaggg ccggggtctg 2760 ggctcacgcc ctgcagtcct gggccgacac agctccgggg aaggcggagg tccttgggga 2820 gagctgccct gagccaggcc ggagcggtga ccctggggcc cggcccctct tgtccccaga 2880 gtgtcccacg ggcacctgtt ggttctgagt cttagtgggg ctactgggga cacgggccgt 2940 agctgagtcg agagctgggt gcagggtggt caaaccctgg ccagacctgg agttcaggag 3000 ggccccgggc caccctgacc tttgaggggc tgctgtagca tgatgcgggt ggccctgggc 3060 acttcgagat ggccagagtc cagcttcccg tgtgtgtggt gggcctgggg aagtggctgg 3120 tggagtcggg agcttcgggc caggcaaggc ttgatcccac agcagggagc ccctcaccca 3180 ggcaggcggc cacaggccgg tccctcctga tcccatccct cctttcccag ggagtggagg 3240 atgccttcta cacgttggtg cgtgagatcc ggcagcacaa gctgcggaag ctgaaccctc 3300 ctgatgagag tggccccggc tgcatgagct gcaagtgtgt gctctcctga cgcaggtgag 3360 ggggactccc agggcggccg ccacgcccac cggatgaccc cggctccccg cccctgccgg 3420 tctcctggcc tgcggtcagc agcctccctt gtgccccgcc cagcacaagc tcaggacatg 3480 gaggtgccgg atgcaggaag gaggtgcaga cggaaggagg aggaaggaag gacggaagca 3540 aggaaggaag gaagggctgc tggagcccag tcaccccggg accgtgggcc gaggtgactg 3600 cagaccctcc cagggaggct gtgcacagac tgtcttgaac atcccaaatg ccaccggaac 3660 cccagccctt agctcccctc ccaggcctct gtgggccctt gtcgggcaca gatgggatca 3720 cagtaaatta ttggatggtc ttgatcttgg ttttcggctg agggtgggac acggtgcgcg 3780 tgtggcctgg catgaggtat gtcggaacct caggcctgtc cagccctggg ctctccatag 3840 cctttgggag ggggaggttg ggagaggccg gtcaggggtc tgggctgtgg tgctctctcc 3900 tcccgcctgc cccagtgtcc acggcttctg gcagagagct ctggacaagc aggcagatca 3960 taaggacaga gagcttactg tgcttctacc aactaggagg gcgtcctggt cctccagagg 4020 gaggtggttt caggggttgg ggatctgtgc cggtggctct ggtctctgct gggagccttc 4080 ttggcggtga gaggcatcac ctttcctgac ttgctcccag cgtgaaatgc acctgccaag 4140 aatggcagac atagggaccc cgcctcctgg gccttcacat gcccagtttt cttcggctct 4200 gtggcctgaa gcggtctgtg gaccttggaa gtagggctcc agcaccgact ggcctcaggc 4260 ctctgcctca ttggtggtcg ggtagcggcc agtagggcgt gggagcctgg ccatccctgc 4320 ctcctggagt ggacgaggtt ggcagctggt ccgtctgctc ctgccccact ctcccccgcc 4380 cctgccctca ccctaccctt gccccacgcc tgcctcatgg ctggttgctc ttggagcctg 4440 gtagtgtcac tggctcagcc ttgctgggta tacacaggct ctgccaccca ctctgctcca 4500 aggggcttgc cctgccttgg gccaagttct aggtctggcc acagccacag acagctcagt 4560 cccctgtgtg gtcatcctgg cttctgctgg gggcccacag cgcccctggt gcccctcccc 4620 tcccagggcc cgggttgagg ctgggccagg ccctctggga cggggacttg tgccctgtca 4680 gggttcccta tccctgaggt tgggggagag ctagcagggc atgccgctgg ctggccaggg 4740 ctgcagggac actccccctt ttgtccaggg aataccacac tcgcccttct ctccagcgaa 4800 caccacactc gcccttctct ccaggggacg ccacactccc ccttctgtcc aggggacgcc 4860 acactccccc ttctctccag gggacgccac actcgccctt ctctccaggg gacgccacac 4920 tcgcccttct ctccagggga cgccacactc gcccttctgt ccaggggacg ccacactcgc 4980 ccttctctcc aggggacgcc acactcgccc ttctctccag gggacgccac actccccctt 5040 ctgtccaggg gacgccacac tcccccttct ctccagggga cgccacactc ccccttctct 5100 ccaggggacg ccacactcgc ccttctctcc aggggacgcc acactccccc ttctgtccag 5160 gggacgccac actcgccctt ctctccaggg gacgccacac tcgcccttct ctccagggga 5220 cgccacactc ccccttctct ccaggggacg ccacactccc ccttctctcc aggggacgcc 5280 acactccccc ttctgtccag gggacgccac actcgccctt ctctccaggg gacgccacac 5340 tcccccttct ctccagggga cgccacactc ccccttctct ccaggggacg ccacactccc 5400 ccttctgtcc aggggacgcc acactcgccc ttctctccag gggacgccac actcgccctt 5460 ctctccaggg gacgccacac tcgcccttct ctccagggga cgccacactt gcccttctgt 5520 ccagggaatg ccacactccc ccttctcccc agcagcctcc gagtgaccag cttccccatc 5580 gatagacttc ccgaggccag gagccctcta gggctgccgg gtgccaccct ggctccttcc 5640 acaccgtgct ggtcactgcc tgctgggggc gtcagatgca ggtgaccctg tgcaggaggt 5700 atctctggac ctgcctcttg gtcattacgg ggctgggcag ggcctggtat cagggccccg 5760 ctggggttgc agggctgggc ctgtgctgtg gtcctggggt gtccaggaca gacgtggagg 5820 ggtcagggcc cagcacccct gctccatgct gaactgtggg aagcatccag gtccctgggt 5880 ggcttcaaca ggagttccag cacgggaacc actggacaac ctggggtgtg tcctgatctg 5940 gggacaggcc agccacaccc cgagtcctag ggactccaga gagcagccca ctgccctggg 6000 ctccacggaa gccccctcat gccgctaggc cttggcctcg gggacagccc agctaggcca 6060 gtgtgtggca ggaccaggcc cccatgtggg agctgacccc ttgggattct ggagctgtgc 6120 tgatgggcag gggagagcca gctcctcccc ttgagggagg gtcttgatgc ctggggttac 6180 ccgcagaggc ctgggtgccg ggacgctccc cggtttggct gaaaggaaag cagatgtggt 6240 cagcttctcc actgagccca tctggtcttc ccggggctgg gccccataga tctgggtccc 6300 tgtgtggccc ccctggtctg atgccgagga tacccctgca aactgccaat cccagaggac 6360 aagactggga agtccctgca gggagagccc atccccgcac cctgacccac aagagggact 6420 cctgctgccc accaggcatc cctccaggga tcc 6453 //